View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_303 (Length: 208)
Name: NF11069A_low_303
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_303 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37821843 - 37821636
Alignment:
| Q |
1 |
aatattgaagttatgtaaagattccaggacttaacaagattctatacccaaccttgtattaagattttctatatctgtagctttaattttgcaggcaagt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37821843 |
aatatggaagttatgtaaagattccaggacttaacaagattctatacccaaccttgtattaagattttctatatctgtagctttaattttgcaggcaagt |
37821744 |
T |
 |
| Q |
101 |
ttaaattatttgatctggggctgcattataaaatgtgcaattgattgtgtgaagatgtcgttgaattggtgttgcatcttaacatctgtgcacttgagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37821743 |
ttaaattatttgatctggggctgcattataaaatgtgcaattgattgtgtgaagatgtcgttgaattggtgttgcatcttaacttctgtgcacttgagac |
37821644 |
T |
 |
| Q |
201 |
tgacatta |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
37821643 |
tgacatta |
37821636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University