View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_306 (Length: 207)
Name: NF11069A_low_306
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_306 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 20574274 - 20574482
Alignment:
| Q |
1 |
gatagtggggttttgaaggtggatttcgctgcaaaggataattccttgggttcaaaaaataa--gtgttcctttagtgtgaaagatgttaatattcctag |
98 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20574274 |
gatagtggggttttgaaggtggatttggctgcaaaggataattccttgggttcaaaaaataacagtgttcctttagtgtgaaagatgttaatattcttag |
20574373 |
T |
|
| Q |
99 |
taacaatgatgtattctaaagggtcgtaaaccgagaaaagggttgtttgcaccatctttgttggatttgaaaagggtggcacggttgtcatcaagggata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
20574374 |
taacaatgatgtattctaaagggtcgtaaaccgagaaaagggttgtttgcaccatctttgttggatctgaaaagggtggcacgattgtcatcaagggata |
20574473 |
T |
|
| Q |
199 |
ggaatgagt |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
20574474 |
ggaatgagt |
20574482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University