View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_309 (Length: 205)

Name: NF11069A_low_309
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_309
NF11069A_low_309
[»] chr2 (1 HSPs)
chr2 (20-124)||(13116996-13117100)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 13116996 - 13117100
Alignment:
20 aatacgtgttatatactattgaaagaacttgagcaatatgactcttgtatgatgattgtattatattttttgtctctaatgtgagaactaattttgttga 119  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||    
13116996 aatacgtcttatatactattgtaagaacttgagcaatatgactcttgtatgataattgtattatattttttgtctctaatgtgagaactaatgttgctga 13117095  T
120 gcaaa 124  Q
    |||||    
13117096 gcaaa 13117100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University