View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_309 (Length: 205)
Name: NF11069A_low_309
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_309 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 13116996 - 13117100
Alignment:
| Q |
20 |
aatacgtgttatatactattgaaagaacttgagcaatatgactcttgtatgatgattgtattatattttttgtctctaatgtgagaactaattttgttga |
119 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
13116996 |
aatacgtcttatatactattgtaagaacttgagcaatatgactcttgtatgataattgtattatattttttgtctctaatgtgagaactaatgttgctga |
13117095 |
T |
|
| Q |
120 |
gcaaa |
124 |
Q |
| |
|
||||| |
|
|
| T |
13117096 |
gcaaa |
13117100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University