View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_312 (Length: 203)
Name: NF11069A_low_312
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_312 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 35489754 - 35489919
Alignment:
| Q |
17 |
ggacatcaagagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaag |
116 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489754 |
ggacttcaagagagcatatttcactgggaactaaccatcccagcgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaag |
35489853 |
T |
 |
| Q |
117 |
atcagcttcggtttttgtaaacgagccttcaccgctaactccaagtttgatagcaatcatacttcc |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489854 |
atcagcttcagtttttgtaaacgagccttcaccgctaactccaagtttgatagcaatcatacttcc |
35489919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 25 - 126
Target Start/End: Complemental strand, 14233181 - 14233080
Alignment:
| Q |
25 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcagctt |
124 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |||||||| || |||| |
|
|
| T |
14233181 |
agagcgcatatttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaagaacaagagaaggtcggctt |
14233082 |
T |
 |
| Q |
125 |
cg |
126 |
Q |
| |
|
|| |
|
|
| T |
14233081 |
cg |
14233080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 25 - 126
Target Start/End: Complemental strand, 14242855 - 14242754
Alignment:
| Q |
25 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcagctt |
124 |
Q |
| |
|
|||| ||||| ||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |||||||| || |||| |
|
|
| T |
14242855 |
agagcgcatacttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaagaacaagagaaggtcggctt |
14242756 |
T |
 |
| Q |
125 |
cg |
126 |
Q |
| |
|
|| |
|
|
| T |
14242755 |
cg |
14242754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University