View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_313 (Length: 203)
Name: NF11069A_low_313
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_313 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 21 - 188
Target Start/End: Complemental strand, 7997183 - 7997016
Alignment:
| Q |
21 |
ttcaggatcttctttatccatctttgagtataagtatggtttcctagaaagagccatatttttcttcaatgtgtttttcttcctctnnnnnnnntaaatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7997183 |
ttcaggatcttctttatccatctttgagtatgagtatggtttcctagaaagagccatatttttcttcaatgtgtttttcttcctctaaaaaaaataaatt |
7997084 |
T |
 |
| Q |
121 |
tgttgatgaaaacttgcactaggaaattaagaaagaggaagaggtagatgtggatttagatttggctt |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7997083 |
tgttgatgaaaacttgcactaagaaattaagaaagaggaagaggtagatgtggatttagatttggctt |
7997016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University