View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_314 (Length: 201)
Name: NF11069A_low_314
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_314 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 27326221 - 27326049
Alignment:
| Q |
22 |
gaattaacaagaaggaaggatcgatcttgcttactaactacaaaactgtgcatagcaaatattaatcttatggaaatcagtagagctacagctctcactt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27326221 |
gaattaacaagaaggaaggatcgatcttgcttactaactacaaaactgtgcatagcaaacattaatcttatggaaatcagtagagctacagctctcactt |
27326122 |
T |
 |
| Q |
122 |
ggtctcacaccgtctctccttctcttcacctacctcagcccctcctctttgtaagtttcaattttcatattct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27326121 |
ggtctcacaccgtctctccttctcttcacctacctcagcccctcctctttgtaagtttcaattttcattttct |
27326049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University