View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_64 (Length: 357)
Name: NF11069A_low_64
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 106 - 351
Target Start/End: Complemental strand, 43164545 - 43164298
Alignment:
| Q |
106 |
gttttaggaaccatgctgccggaaaattcacagtaaagattgatggttccattaaaaatcag--tgtcatgcatattttttaagggttattataccagaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43164545 |
gttttaggaaccatgctgccggaaaattcacagtaaagattgatggttccattaaaaatcagagtgtcatgcatattttttaaaggttattataccagaa |
43164446 |
T |
|
| Q |
204 |
ctttagaaacaaaaagaacccaaaaaatgtgcttccactacagcattagcattaggacattcatgggatcaagaaacaagagtaaaagacaacaaaaatc |
303 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164445 |
ctttagaaacaaaaagaacccaagaaatgtgcttccactacagcattagcattaggccattcatgggatcaagaaacaagagtaaaagacaacaaaaatc |
43164346 |
T |
|
| Q |
304 |
aagcagagatgtatagcagtacaacacacacttaaaagctgatctgga |
351 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43164345 |
aagcagagacgtatagcagtacaacacacactcaaaagctgatctgga |
43164298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 43164967 - 43164862
Alignment:
| Q |
1 |
gaaacgatagcactaaaattcgtgccttgagcattcgagtaaattgcattcactaaaatttgtgaatcactctcaagcacaactcactcaaaacctttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
43164967 |
gaaacgatagcactaaaattcgtgccttgagcattcgagtaaattgcattcactaaactttgcgaatcactctcaaacacaactcgctcaaaacctttat |
43164868 |
T |
|
| Q |
101 |
tggatg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
43164867 |
tggatg |
43164862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 24 - 106
Target Start/End: Original strand, 32077789 - 32077871
Alignment:
| Q |
24 |
gccttgagcattcgagtaaattgcattcactaaaatttgtgaatcactctcaagcacaactcactcaaaacctttattggatg |
106 |
Q |
| |
|
||||||| ||||||||||| | ||||||||||||||||| |||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
32077789 |
gccttgaacattcgagtaagtagcattcactaaaatttgagaattcttctcaaacacaactcgatcaaaacctttattggatg |
32077871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University