View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_81 (Length: 322)
Name: NF11069A_low_81
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_81 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 41735184 - 41734877
Alignment:
| Q |
18 |
gacatcaatttaattgcgaaaatgtcttttatcttgtaattcccatttttcactagtgatgggcgatagtcatatattcttcacaccaattcaatatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735184 |
gacatcaatttaattgcgaaaatgtcttttatcttgtaattcccattttgcactagtgatgggcgatagtcatatattcttcacaccaattcaatatata |
41735085 |
T |
|
| Q |
118 |
gttggcctaat---cagattggtaatctaccatatgccaaccttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgcc |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735084 |
gttggcctaatgatcagattggtaatctaccatatgccaaccttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgcc |
41734985 |
T |
|
| Q |
215 |
actgatcataatatgatgaagcaaaatctattagtgaaaataatcactcttctcccttggcttattcttttcttcattctaacaggtactcataatttgc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41734984 |
actgatcataatatgatgaagcaaaatctattagtgaaaataatcactcttctcccttggcttattcttttcttcattataacaggtactcataatttgc |
41734885 |
T |
|
| Q |
315 |
tagcatct |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
41734884 |
tagcatct |
41734877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University