View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069_high_28 (Length: 243)

Name: NF11069_high_28
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069_high_28
NF11069_high_28
[»] chr3 (1 HSPs)
chr3 (93-146)||(23034254-23034307)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 93 - 146
Target Start/End: Complemental strand, 23034307 - 23034254
Alignment:
93 attacaagagcaagttgttaatcatgtgatttaattaagttatatgttcctaat 146  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
23034307 attacaagaacaagttgttaatcatgtgatttaattaagttatatgttcctaat 23034254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University