View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_high_3 (Length: 535)
Name: NF11069_high_3
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 13 - 501
Target Start/End: Complemental strand, 22422030 - 22421542
Alignment:
| Q |
13 |
gagatgaacgacagactgcaaagcgagaaagcaatgcgtgaagcgagagatgatctcaaccgtcggattcatgatcagaaaatggcgtcggagattttca |
112 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22422030 |
gagatgaacgacagattacaaagcgagagagcaatgcgtgaagcgagagacgatctcaaccgtcggattcatgatcagaaaatggcgtcggagattttca |
22421931 |
T |
|
| Q |
113 |
acatgccggtggaggattgggataaatggggggataattttgagaaaccgtttggtgaagggagtttgtcgggttcgacgagtcggaacgatgatagtcc |
212 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||| |||||| |||| |||| |
|
|
| T |
22421930 |
acatgccggtgaaggattgggatgaatggggagataatttcgagaaaccgtttggtgaagggagttcttcgggttcgacgatgcggaacaatgaaggtcc |
22421831 |
T |
|
| Q |
213 |
ggttgttagggtttattttaagggtttagtgagtgaggaggttgtgagaggtgagaatgtttctttggctgggattggtgttgctgtttgtgatgatgag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22421830 |
ggttgttagggtttattttaagggtttagtgagtgaggagagtgtgagaggtgagagtgtttctttggctgggattggtgttgctgtttgtgatgatgag |
22421731 |
T |
|
| Q |
313 |
gataatttgatattggaaatttctaaggctgttgttgggaatgaaagtaggaaaattgttgtggagcttatggctttgattgaaggtttcaatgctgtta |
412 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| ||| | ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22421730 |
gataatttgatattggaaatttctaagactgttgatgggaatgagagtcgtaaaattgctgtggagcttatggctttgattgaaggtttcaatgctgtta |
22421631 |
T |
|
| Q |
413 |
ttgctttggatttgaagcgtgttatttattttggtgattattatacactttttcaacatgtgagttcttcttactctctctaaatggtt |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22421630 |
ttgctttggatttgaagcgtgttatttattttggtgattattatacactttttcaacatgtgagttcttcttactctctctaaatggtt |
22421542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University