View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_high_35 (Length: 218)
Name: NF11069_high_35
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 12844054 - 12843870
Alignment:
| Q |
21 |
tccgccaccttcaataccttcgccgcaaccgtaatctccgtaaccgtaatctcgttgtcggccttggcgttcaatggactcccggcaaccttgatcctcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844054 |
tccgccaccttcaataccttcgccgcaaccgtaatctctgtaaccgtaatctcattgtcggccttggcgttcaatggactcccggcaaccttgatcctcc |
12843955 |
T |
 |
| Q |
121 |
cgccgacacgctacagttatgcatcagtggcagctgtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
12843954 |
cgccgacacgctacagttatgcatcagtggcagctgtcttatcttccacctctctctcgccgatatgattccggttagtctctgc |
12843870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 205
Target Start/End: Original strand, 12861462 - 12861611
Alignment:
| Q |
56 |
ctccgtaaccgtaatctcgttgtcggccttggcgttcaatggactcccggcaaccttgatcctcccgccgacacgctacagttatgcatcagtggcagct |
155 |
Q |
| |
|
||||| ||| ||||||| ||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12861462 |
ctccgcaactgtaatcttgttgtcggcctcggcgttcaatggactaaccgcaaccttgatcctcccgccgacacgctacagttatgcatcggtggcagct |
12861561 |
T |
 |
| Q |
156 |
gtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861562 |
gtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgc |
12861611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University