View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_high_38 (Length: 211)
Name: NF11069_high_38
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 83 - 193
Target Start/End: Complemental strand, 9575077 - 9574967
Alignment:
| Q |
83 |
ccacaatgggattctctcaaattattttgaccactctttatttatttatcaacatggcaatgacatcgtctatattcttttgtatgtggatgccattatt |
182 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||| |
|
|
| T |
9575077 |
ccacaatgggattctcttaaattattttgaccactctttatttatttatcaacatggcaatgacaccgtctatattcttttgtatgtggatgacatcatt |
9574978 |
T |
 |
| Q |
183 |
cttgccgcttc |
193 |
Q |
| |
|
||||||||||| |
|
|
| T |
9574977 |
cttgccgcttc |
9574967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 9575180 - 9575109
Alignment:
| Q |
15 |
catcatactcaactccctggccatgtctgtcttctaaaaaattctctccatggacttatacaagcaccccac |
86 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9575180 |
catcatactcaactccctggccatgtatgtcttctaaaaaattctctccatggacttatacaagcaccccac |
9575109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University