View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_low_26 (Length: 256)
Name: NF11069_low_26
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 46795147 - 46795402
Alignment:
| Q |
1 |
ccattcatattattttcgtggtgagttcgtagttataatttcgttcttaccttttcatggcttcttttgattggttcagtaatttatgttttctggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795147 |
ccattcatattattttcgtggtgagttcgtagttataatttcgttcttaccttttcatggcttcttttgattggttcagtaatttatgttttctggattt |
46795246 |
T |
|
| Q |
101 |
caaatcaatcaatcaatttatgttttctgtaattttgtgtctttcgttttaccctgacca------caaccccaaccccaacccttgttttgttactgga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
46795247 |
caaatcaatcaatcaatttatgttttctgtaattttatgtcttttgttttaccctgaccacaaccccaaccccaaccccaacccttgttttgttattgga |
46795346 |
T |
|
| Q |
195 |
aaatggaaagctgatgatagaagaaatttaggcattgtgatttgtgatgtccatct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46795347 |
aaatggaaagctgatgatagaagaaatttaggtattgtgatttgtgatgttcatct |
46795402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University