View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_low_32 (Length: 243)
Name: NF11069_low_32
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 93 - 146
Target Start/End: Complemental strand, 23034307 - 23034254
Alignment:
| Q |
93 |
attacaagagcaagttgttaatcatgtgatttaattaagttatatgttcctaat |
146 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034307 |
attacaagaacaagttgttaatcatgtgatttaattaagttatatgttcctaat |
23034254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University