View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_low_40 (Length: 216)
Name: NF11069_low_40
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 33122737 - 33122925
Alignment:
| Q |
18 |
agagagactaggaatattaagaattgctgctacgttaaaaatagatagaactaactcaatattccaagagttgttggcatgaata------ataataata |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
33122737 |
agagagactaggaatattaagaattgcagctacgttaaaaatagacagaactaactcaatattccaagagttgttgaaatgaataataataataataatg |
33122836 |
T |
 |
| Q |
112 |
tgacttgctagaagctcatacaaatgtgattgcatagcttacttattgattttaatgtatttgaaatactggtgtataagatcataagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33122837 |
tgacttgctagaagctcatacaaatgtgatttcatagcttacttattgattttaatgtatttgaaatactggtgtataagatcataagt |
33122925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University