View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_low_41 (Length: 215)
Name: NF11069_low_41
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 2341511 - 2341329
Alignment:
| Q |
15 |
cagagaaaaatgattgggacatctgcaaggcccgagggttttcaactgagacaccagagagaatttctgacatatgcaaggcctgagggttttcaattaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341511 |
cagagaaaaatgattgggacatctgcaaggcccgagggttttcaactgagacaccagagagaatttctgacatatgcaaggcctgagggttttcaattaa |
2341412 |
T |
 |
| Q |
115 |
gacaccagagagaaattcttgggacatctgcatggcccaagggccttcaggaattggtcctccatattgctccaacggaaggt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341411 |
gacaccagagagaaattcttgggacatctgcaaggcccaagggccttcaggaattggtcctccatattgctccaacggaaggt |
2341329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University