View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069_low_8 (Length: 503)
Name: NF11069_low_8
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 8e-56; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 1957080 - 1956962
Alignment:
| Q |
18 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1957080 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaaatt |
1956981 |
T |
|
| Q |
118 |
caatcaaatccataatatg |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1956980 |
taatcaaatccataatatg |
1956962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 1942161 - 1942053
Alignment:
| Q |
18 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
117 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||| |||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
1942161 |
tgttcacccatttcaaacccttttcagtgtatgtctcctcattgtagttgcttgtgaaaaatctatcaccctctagcctcctgcaaagtgcattaaagtt |
1942062 |
T |
|
| Q |
118 |
caatcaaat |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
1942061 |
caatcaaat |
1942053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 421 - 496
Target Start/End: Complemental strand, 1956853 - 1956778
Alignment:
| Q |
421 |
tttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcttctct |
496 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1956853 |
tttttacctagatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcttctct |
1956778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 1928184 - 1928076
Alignment:
| Q |
18 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
117 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||||||||| ||| |||||||||||| |||||| | ||||||||||| |||||||||| |||||| |
|
|
| T |
1928184 |
tgttgacccattctaacccctttttggtgtatgtctcctcattgtagtagcttgtgaaaaatctatcaccttctagcctcctacaaagtgcattaaagtt |
1928085 |
T |
|
| Q |
118 |
caatcaaat |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
1928084 |
caatcaaat |
1928076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 422 - 496
Target Start/End: Complemental strand, 1941761 - 1941687
Alignment:
| Q |
422 |
ttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcttctct |
496 |
Q |
| |
|
|||||||| |||||||||| |||||| || | ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1941761 |
ttttacctagatgccatgagaaggaagattaaaaaagctgtctcactaattgcaaaaccctttatcttcttctct |
1941687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 373 - 496
Target Start/End: Complemental strand, 1927701 - 1927577
Alignment:
| Q |
373 |
aatattatgaaggtataaacataaataaaacaaaacaagttttagt-attttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaat |
471 |
Q |
| |
|
||||||||||||||| |||||| ||||||| |||| || | | | | ||||||||||| |||||||||| ||| ||||| ||||| ||| ||||| || |
|
|
| T |
1927701 |
aatattatgaaggtaaaaacatcaataaaataaaataattgtaatttattttttacctagatgccatgagaagaaatattgtaaaagctgtttcacttat |
1927602 |
T |
|
| Q |
472 |
tgcaaaaccctttatcttcttctct |
496 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1927601 |
tgcaaaaccctttatcttcttctct |
1927577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 175 - 218
Target Start/End: Complemental strand, 36774912 - 36774869
Alignment:
| Q |
175 |
atactgaggcatatcacacttgttcttatgggatttaaaaatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774912 |
atactgaggcatatcacacttgttcttatgggatttaaaaatta |
36774869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University