View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1106_low_2 (Length: 364)
Name: NF1106_low_2
Description: NF1106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1106_low_2 |
 |  |
|
| [»] scaffold0722 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0722 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 142 - 268
Target Start/End: Original strand, 5725 - 5850
Alignment:
| Q |
142 |
ttatcgaatatattatatacttgacaattggtggtgaaagaaaaaagtatacatatatcctccttnnnnnnnnnnngtttacatattatggtcctgaact |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5725 |
ttatcgaatatattatataattgacaattg-tggtggaagaaaaaagtatacatatatcctccttaaaaaaaaaaagtttacatattatggtcctgaact |
5823 |
T |
 |
| Q |
242 |
cattatcatcatcatgtactacatttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5824 |
cattatcatcatcatgtactacatttt |
5850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University