View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11070_high_10 (Length: 290)
Name: NF11070_high_10
Description: NF11070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11070_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 10560007 - 10559722
Alignment:
| Q |
1 |
tttggttcgtgactttttcggcgaccatggtttgattggtcgtcgccgtgtttctaaaactattggtatatttacactgctcctttttcgtcgccgactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10560007 |
tttggttcgtgactttttcggcgaccatggtttgattggtcgtcgctgtgtttctaaaactattggtatatttacgctgctcctttttcgtcgccgactt |
10559908 |
T |
 |
| Q |
101 |
attcgtggcttccgtgactattggtatattcacgatgctccttgattggttgttttagtgggtttatgggagcgctgaaggttttgtctctggtttttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10559907 |
attcgtggcttccgtgactattggtatattcacgatgctccttgattggttgtttcagtgggtttatgggagcgccgaaggttttgcctctggtttttat |
10559808 |
T |
 |
| Q |
201 |
tgctcaaaagagccaaggcttcacgaactggatgctcttctgcatctcaggttgcctcatagtcgtttatgcttgttcttctcact |
286 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10559807 |
tgctcaaaagagccaaggcttcacgagcttgatgttcttctgcatctcaggttgcctcatagtcgtttatgcttgttgttttcact |
10559722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University