View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11070_low_11 (Length: 271)
Name: NF11070_low_11
Description: NF11070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11070_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 36571761 - 36572010
Alignment:
| Q |
14 |
gatgaagtggatagatctcgtttgcagctttataagagagagatgggcaaaa-ggtgaaaaatatatatgtagaaat-----gaataaatgaaaactggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36571761 |
gatgaagtggatagatctcgtttgcagctttataagagagagatgggcaaaaaggtgaaaaatatatatgtagaaattaaatgaataaatgaaaactggg |
36571860 |
T |
 |
| Q |
108 |
agtgtgcattgtggagcccaatttgtgttggttagggtgattggtaacatatactgatatgaatacat---tacattcaccacccttccttctgctggat |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36571861 |
agtgtgcaatgtggagcccaatttgtgttggttggggtgattggtaacatatactgatatgaatacattactacattcaccacccttccttctgctggat |
36571960 |
T |
 |
| Q |
205 |
aaactgtagtttgtgatctgaaacgacctttcaactattttcatttgact |
254 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36571961 |
aaactgtagtttgtgatcagaaacgacctttcaactattttcatttgact |
36572010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University