View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11071_high_7 (Length: 242)
Name: NF11071_high_7
Description: NF11071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11071_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 226
Target Start/End: Original strand, 43428353 - 43428576
Alignment:
| Q |
3 |
aggaggagcacagaatacgatagaatcgaacaaaacgaacgacgcacacaaaatttggaagctaagaaaatgggttgggtttggagcgacgacgataaca |
102 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43428353 |
aggaggaacacaaaatacgatagaatcgaacaaaacgaacgacgcacacaaaatttggaagctaagaaaatgggttgggtttggagcgacgacgataaca |
43428452 |
T |
|
| Q |
103 |
acagctcttcaggttccgatgaacgatgctccaccaggaaagtcgtgaaatctcagtgcaaaaccgaagaggttgaacctggaaaattcgttcggaaatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43428453 |
acagctcttcaggttccgatgaacgatgctccaccaggaaagtcgtgaaatctcagtgcaaaaccgaagaggttgaacctggaaaattcgttcggaaatg |
43428552 |
T |
|
| Q |
203 |
cgagaaaactgaagagcttctcaa |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43428553 |
cgagaaaactgaagagcttctcaa |
43428576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University