View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11071_low_3 (Length: 321)
Name: NF11071_low_3
Description: NF11071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11071_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 28524403 - 28524681
Alignment:
| Q |
1 |
atgggaaataaagtttatatataaattggtcaaatctggtatgattaccgacacctctgattgaatttgtgtctggtggtgaggcatggacacatgtgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524403 |
atgggaaataaagtttatatataaattggtcaaatctggtatgattaccgacacctctgattggatttgtgtctggtggtgaggcatggacacatgtgat |
28524502 |
T |
|
| Q |
101 |
tgcattctatcaattcattttttcaaattattactgatgtcggtgttagtattgtgtttggtgtcaatgcttatagataatgtgtgcacgttgtaactgt |
200 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28524503 |
tacattctatcatttcattttttcaaattattactgatgtcggtgttagtattgtgtttggtgtcaatgcttatagataatgtgtgcaagttgtaactgt |
28524602 |
T |
|
| Q |
201 |
gtacccttcggtgtacctctataaccaaatcgttcttatattataaatttataatctggctgttatttgaaagagttcc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524603 |
gtacccttcggtgtacctctataaccaaatcgctcttatattataaatttataatctggctgttatttgaaagagttcc |
28524681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 141
Target Start/End: Original strand, 12440469 - 12440501
Alignment:
| Q |
109 |
atcaattcattttttcaaattattactgatgtc |
141 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
12440469 |
atcaattcattttttcaaattattagtgatgtc |
12440501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 141
Target Start/End: Original strand, 36768856 - 36768908
Alignment:
| Q |
89 |
gacacatgtgattgcattctatcaattcattttttcaaattattactgatgtc |
141 |
Q |
| |
|
||||||||||||| ||||| || |||| ||| | ||||||||||||||||||| |
|
|
| T |
36768856 |
gacacatgtgattacattcaattaattaattctctcaaattattactgatgtc |
36768908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University