View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11073_high_24 (Length: 278)
Name: NF11073_high_24
Description: NF11073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11073_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 40854124 - 40854339
Alignment:
| Q |
18 |
ctatattggccatcctgcatttcccatggcgttgtctggtaatttaaaaacataaaacgtcctgatattttttgggattattgtgatgccatgaggaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40854124 |
ctatattggccatcctgcatttcccatggcgttgtctggtaatttaaaaacataaaacgtcctgatattttttgggattattgtgatgacatgaggaatc |
40854223 |
T |
|
| Q |
118 |
atgtttcttttattgacagtgtaagatattttactaaggttaacttgtgcaactttgattttagtggactcaattcttaggttgtttcaactgatatcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854224 |
atgtttcttttattgacagtgtaagatattttactaaggttaacttgtacaactttgattttagtggactcaattcttaggttgtttcaactgatatcag |
40854323 |
T |
|
| Q |
218 |
cttctagctagtgtta |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40854324 |
cttctagctagtgtta |
40854339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University