View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11073_low_27 (Length: 223)
Name: NF11073_low_27
Description: NF11073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11073_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 34 - 206
Target Start/End: Original strand, 11984031 - 11984203
Alignment:
| Q |
34 |
tcagccctccattttacaactttgttggtctttagtaacttcaatgtctgatcttcaattttgtctggtatgaaattgtatcttagtttaatatatgaac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11984031 |
tcagccctccattttacaactttgttggtctttagtaacttcaatgtctgatcttcaattttgtctggtatgaaattgtatcttagtttaatatatgaac |
11984130 |
T |
|
| Q |
134 |
actcctccagttctataggcaatgaaaatactttcagtttctggacagatggattgctggataagccaattgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11984131 |
actcctccagttctataggcaatgaaaatactttcagtttctggacagatggattgctggataagccaattgt |
11984203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University