View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11073_low_29 (Length: 215)
Name: NF11073_low_29
Description: NF11073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11073_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 23517647 - 23517824
Alignment:
| Q |
15 |
gagatgaagaaggtttgaagattgaaaatggaaggaagaaagggtttgagaatgttaaatgaaagctaagacgcgttgaagaatagaatgtgaatgggaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23517647 |
gagatgaagaaggtttgaagattgaaaatggaatgaagaaagggtttgagaatgttaaatggaagctaagacgcgttgaagaatagaatgtgaatgggaa |
23517746 |
T |
 |
| Q |
115 |
tggaagaaaaggaaggaagatgcgttgagtataaaaggagggagggaaggaaacaagtaaataccgcagacaatatgatttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23517747 |
tggaagaaaaggaaggaagatgcgttgagtataaaa----ggagggaaggaaacaagtaaataccgcagacaatatgatttt |
23517824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University