View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11073_low_30 (Length: 211)
Name: NF11073_low_30
Description: NF11073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11073_low_30 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 42087679 - 42087469
Alignment:
| Q |
1 |
caaagaagaaaaacaagaagatagaaaacaagagaaggtttagtgatgaacagataagatcactagaatgcatatttgagtcagaatcaaagttggaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087679 |
caaagaagaaaaacaagaagatagaaaacaagagaaggtttagtgatgaacagataagatcactagaatgcatatttgagtcagaatcaaagttggaacc |
42087580 |
T |
|
| Q |
101 |
aaggaagaagatgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaaaaggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087579 |
aaggaagaagatgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaaaaggata |
42087480 |
T |
|
| Q |
201 |
gaacaagaata |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
42087479 |
gaacaagaata |
42087469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 187
Target Start/End: Original strand, 39342692 - 39342750
Alignment:
| Q |
129 |
cttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaa |
187 |
Q |
| |
|
||||| ||||||||||||||||| ||| | ||||| || ||||| |||||||||||||| |
|
|
| T |
39342692 |
cttgggttgcagcctagacaagtagctgtttggttccaaaacaggagagcaagatggaa |
39342750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 96 - 193
Target Start/End: Original strand, 9379021 - 9379118
Alignment:
| Q |
96 |
gaaccaaggaagaagatgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaa |
193 |
Q |
| |
|
|||||||| |||||| |||| | || ||||| ||||| |||||||| ||||||||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
9379021 |
gaaccaagaaagaagttgcagttagctagagagcttggattgcagccaagacaagttgctatatggtttcaaaacaaaagagctagatggaaatcaaa |
9379118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 24692455 - 24692391
Alignment:
| Q |
111 |
atgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaag |
175 |
Q |
| |
|
||||| || ||||||| |||||| |||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
24692455 |
atgcagctagcaagagctcttggattgcagccaagacaaattgctatatggtttcaaaacagaag |
24692391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 114 - 181
Target Start/End: Complemental strand, 16763066 - 16762999
Alignment:
| Q |
114 |
caacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaag |
181 |
Q |
| |
|
|||||||||| ||| ||||||||||| || ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
16763066 |
caacttgcaaaagagcttggtttgcaaccaagacaagttgctatatggtttcaaaacagaagggcaag |
16762999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 111 - 187
Target Start/End: Complemental strand, 17181983 - 17181907
Alignment:
| Q |
111 |
atgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaa |
187 |
Q |
| |
|
||||| |||||||||| |||| ||||| |||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
17181983 |
atgcagcttgcaagagctcttaacttgcaacctagacaagttgctatatggtttcaaaatagaagggcaagatggaa |
17181907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 193
Target Start/End: Complemental strand, 2342836 - 2342778
Alignment:
| Q |
135 |
ttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaa |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
2342836 |
ttgcagcctagacaaattgctatatggtttcagaatagaagagcaagatgcaaaacaaa |
2342778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University