View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11074_high_8 (Length: 226)
Name: NF11074_high_8
Description: NF11074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11074_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 55011404 - 55011602
Alignment:
| Q |
8 |
gaggagcagagacagaagtggcgtgcgaattcaggtttgagtgatgggtggacttacaacactgatcttactggcggttactacgacgccggtgataaca |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55011404 |
gaggaccagagacagaagtggcgtgcgaattcaggtttgagtgatgggtggacttacaacactgatcttactggcggttactacgacgccggtgataaca |
55011503 |
T |
|
| Q |
108 |
tcaagtttgggtttccgatggcgtttacgacgacaatgttgtcatggagtgtgattgagtttggtgaaaacatgcctcctaatgaactcagaaacgctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55011504 |
tcaagtttgggtttccgatggcgtttacgacgacaatgttgtcatggagtgtgattgagtttggtgaaaacatgcctcctaatgaactcagaaacgctt |
55011602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 83 - 171
Target Start/End: Original strand, 44151980 - 44152068
Alignment:
| Q |
83 |
ggttactacgacgccggtgataacatcaagtttgggtttccgatggcgtttacgacgacaatgttgtcatggagtgtgattgagtttgg |
171 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| |||||||||||||||||||| ||||| ||||| | |||||||||||||| ||||| |
|
|
| T |
44151980 |
ggttactacgacgccggcgacaacataaagttcgggtttccgatggcgtttacaacgacgatgttagcttggagtgtgattgattttgg |
44152068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 173
Target Start/End: Complemental strand, 39419599 - 39419534
Alignment:
| Q |
108 |
tcaagtttgggtttccgatggcgtttacgacgacaatgttgtcatggagtgtgattgagtttggtg |
173 |
Q |
| |
|
|||||||||| ||||| ||||| ||||| || || ||| | ||||||||||| ||||||||||||| |
|
|
| T |
39419599 |
tcaagtttggttttcctatggcttttactaccactatgctttcatggagtgttattgagtttggtg |
39419534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University