View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11075_high_6 (Length: 213)
Name: NF11075_high_6
Description: NF11075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11075_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 46366550 - 46366733
Alignment:
| Q |
12 |
tgagatgaaggcaaagacaaaagaacccaacatcctcgaagtgggggtgtggtatagggtgcaatgtagtagtacaaaatgtgcgatatattgggatgtg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366550 |
tgagaagaaggcaaagacaaaagaacccaacatcctcgaagtgggggtgtggtatagggtgcaatgtagtagtacaaaatgtgcgatatattgggatgtg |
46366649 |
T |
 |
| Q |
112 |
tttgtcactttgttgtgttttgtggaagagaaggtcccaccacacgcacttgctctttctttggttgcttgggaagactcaccc |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366650 |
tttgtcaccttgttgtgttttgtggaagagaaggtcccaccacacgcacttgctctttctttggttgcttgggaagactcaccc |
46366733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University