View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11077_low_4 (Length: 349)
Name: NF11077_low_4
Description: NF11077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11077_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 28014338 - 28014679
Alignment:
| Q |
1 |
agttctaagttgttgctctttatgtctcgtaactaaagttattgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcatttttaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28014338 |
agttctaagttgttgctctttatgtcttgtaactaaagttattgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcattttttaaa |
28014437 |
T |
 |
| Q |
101 |
ttacatttgaatgtgcaagaaaataacatgaagaaagaacgtaaagttgttgacttattgtttcacaactggaggatttaatttcaaaattacacatact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28014438 |
ttacatttgaatgtgcaagaaaataacatcaagaaagaccgtaaagctgttgacttattgtttcacaactgaaggatttaatttcaaaattacacatact |
28014537 |
T |
 |
| Q |
201 |
aaccaatattcatttgcattttaactaaaagtttgcaaaccccgattcaaaagaatctcactctcatctaaggattcactcaccnnnnnnnccttctaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28014538 |
aaccaatattcatttgcattttaactgaaagtttgcacaccccgattcaaaagaatctcactctcatctaaggattcactcacctttttttccttctaat |
28014637 |
T |
 |
| Q |
301 |
ttcctagtataagctctcatctccacattttggcttcatctc |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28014638 |
ttcctagtataagctctcatctccacattttggcttcttctc |
28014679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University