View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11078_low_3 (Length: 238)
Name: NF11078_low_3
Description: NF11078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11078_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 4288398 - 4288618
Alignment:
| Q |
1 |
gttatcaacggttgagcaaatatttccaccagcag--gcttcattatagaaacacgttcttccatgaccaccattctttaatggatataattatagcttc |
98 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
4288398 |
gttatcaatggttgagcaaatatttccacgagcagaggcttcattatagaaacacgttcttccatgaccaccattcttcaatggatcaaattatagcttc |
4288497 |
T |
 |
| Q |
99 |
tggaaagaaaagatgcaattgtattttaagtctcaagatataagaatgtggagagtaatcatacgttgattacattccaatggttattcaagaggatgaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
4288498 |
tggaaagaaaagatgcaattgtattttaagtctgaagatacaagaatgtggagagtaatcatacgttgattacattcgaatggttactcaagaggatgaa |
4288597 |
T |
 |
| Q |
199 |
actcaaactaagaaatcagaa |
219 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
4288598 |
actcaaactgagaaatcagaa |
4288618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University