View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_high_104 (Length: 207)
Name: NF1107_high_104
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_high_104 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 44879444 - 44879651
Alignment:
| Q |
1 |
ttcattagacaacatcgtgtgacacgttaaatcaatatgtgacgatccacatggacttcacgtcaaaatcacatctccacgcacaaaattgactgtcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44879444 |
ttcattagacaacatcgtgtgacacgttaaatgaatatgtgacgatccacatggacttcacgtcaaaatcacatctccacgcacaaaattgactgtcata |
44879543 |
T |
|
| Q |
101 |
attttgttcggcaataacctaaatgtcactcttccccgtagtttaaaaccaaagtaaatcatatgcgttatcttaacaaaattataa-taacaattttgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44879544 |
attttgttcggcaataacctaaatgtcactcttccccgtagtttaaaaccaaagtaaatcctatgcgttatcttaacaaaattataacaaacaattttgt |
44879643 |
T |
|
| Q |
200 |
ccatgagg |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
44879644 |
ccatgagg |
44879651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University