View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_high_14 (Length: 465)
Name: NF1107_high_14
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 73 - 341
Target Start/End: Complemental strand, 25969021 - 25968753
Alignment:
| Q |
73 |
ggagcagagacatacccaagagacgcaacaacaatgcagacacatttgaaaatcggaaagattcattgaagatcaaccgattcacaagaaattttcgcca |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25969021 |
ggagcagaaacatacccaagagacgcaacaacaatgcagatacatttgaaaatcggaaagattcattgaagaccaaccgattcacaagaaattttcgcca |
25968922 |
T |
 |
| Q |
173 |
gtttaattactctaagaggaggtttaccgacaccaaaagtatctctgccccgtttacgccccacaacacgacatcgttcataatccgtgcgaagaagtct |
272 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25968921 |
gtttaactactctaagaggaggtttaccgacaccaaaagtatctctgccccgtttacaccccacaacacgacatcgttcataatccgtgcgaagaagtct |
25968822 |
T |
 |
| Q |
273 |
ggcgggatagcttccctagtctcaccttgtgcgatgacgccgatgattctaacaactccgacactatat |
341 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25968821 |
ggcgggatagcttccctggtctcaccttgtgcgatgacgccgacgattctaacaactccgacactatat |
25968753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 400 - 465
Target Start/End: Complemental strand, 45307072 - 45307007
Alignment:
| Q |
400 |
atgtagtggggagatgagatatgcacaatcaatattagagagaggggggtcacagacacaatagac |
465 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45307072 |
atgtagtggggagatgagatatgcacaatcaatattagagagaggggggtcacagacacaatagac |
45307007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University