View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_high_57 (Length: 349)
Name: NF1107_high_57
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_high_57 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 139 - 349
Target Start/End: Complemental strand, 24909657 - 24909451
Alignment:
| Q |
139 |
ggtcatttacatcgggttgaatttgtcttcgagtaatacaaggtcatagaatatataggatcatttactctctaataaaggatattacaatttgaatcca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24909657 |
ggtcatttacatcgggttgaatttgtcttcgagtaatacaaggtcatagaata----ggatcatttactctctaataaaggatattacaatttgaatcca |
24909562 |
T |
|
| Q |
239 |
aggtcaattcaagtgtacttagactacactattgatttacaacatgatctaatgactctcttttgaaaggatattacaatgaatttatacatcatgttct |
338 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24909561 |
agatcaattcaagtgtacttagactacactattgatttgcaacatgatctaatcactctcttttgagaggatattacaatgaatttatacatcatgttct |
24909462 |
T |
|
| Q |
339 |
tggtatttctt |
349 |
Q |
| |
|
|||| |||||| |
|
|
| T |
24909461 |
tggtttttctt |
24909451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University