View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_high_85 (Length: 264)
Name: NF1107_high_85
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_high_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 7501881 - 7501847
Alignment:
| Q |
11 |
cacagataagtggcctccgcctccctttttccctt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7501881 |
cacagataagtggcctccgcctccctttttccctt |
7501847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 205
Target Start/End: Original strand, 27257795 - 27257869
Alignment:
| Q |
131 |
tgaatacttgcaagagaatttgaagttaagttggattgtaatcgatccaactcaaaagcatgcagctaacttgtt |
205 |
Q |
| |
|
|||||| |||||||| ||||||| ||| |||||| |||| ||||||||||||| ||||| |||||| || ||||| |
|
|
| T |
27257795 |
tgaatatttgcaagaaaatttgaggttgagttgggttgttatcgatccaactcgaaagcgtgcagcaaagttgtt |
27257869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University