View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_100 (Length: 286)
Name: NF1107_low_100
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 6 - 257
Target Start/End: Original strand, 42968297 - 42968553
Alignment:
| Q |
6 |
agaagcaaaggccttgagacattcagttttatgtccaataccatacactgtggaactagtgaattgtc-----acaatccatggagcacccacccaaccc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42968297 |
agaaacaaaggccttgagacattcagttttatgtccaataccatacactgtggaactagtgaattgtcatgtcacaatccatggagcacccacccaaccc |
42968396 |
T |
 |
| Q |
101 |
aagcatggatgattgagcatatctgctaataaagctgttcttttctgtcatgcaaccatctccaactgttgaaaaaagcacataacagtcagtcatattg |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42968397 |
aagcatggatggttgagcatatctgctaataaagctgttctttcctgtcatgcaaccatctccaactgttgaaaaaagcacataacaatcagtcatattg |
42968496 |
T |
 |
| Q |
201 |
agcatcttgtgtatgatttatttttaccatttcttggttcttgtataaagttccctc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968497 |
agcatcttgtgtatgatttatttttaccatttcttggttcttgtataaagttccctc |
42968553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University