View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_101 (Length: 285)
Name: NF1107_low_101
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 52 - 184
Target Start/End: Complemental strand, 23702609 - 23702477
Alignment:
| Q |
52 |
aatgcaaattttccggtatgcttcatctgtgaaattgaacaagagtaatgttgtgtttcaatgcttacctggacactgcagagagattcaaactctgaaa |
151 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23702609 |
aatgcaaactttacggtacgcttcatctgtgaaattgaataagagtaatgttgtgtttcaatgcttacctggacactgcagagagattcaaactctgaaa |
23702510 |
T |
|
| Q |
152 |
tggtatgcatttgtgcaagaactacttcagccc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23702509 |
tggtatgcatttgtgcaagaactacttcagccc |
23702477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 29 - 184
Target Start/End: Original strand, 23663355 - 23663499
Alignment:
| Q |
29 |
tccaagaatatgagaccagtcagaatgcaaattttccggtatgcttcatctgtgaaattgaacaagagtaatgttgtgtttcaatgcttacctggacact |
128 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23663355 |
tccaaaaacatgagaccagtcagaatgcaaattttccggtatgcttcatctgtgaaattgaacaagagtaatgttgtgtttcaatgcttacc-------- |
23663446 |
T |
|
| Q |
129 |
gcagagagattcaaactctgaaatggtatgcatttgtgcaagaactacttcagccc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23663447 |
---cagagattcaaactctgaaatggtatgcatttgtgcaagaactacttcagccc |
23663499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 189 - 229
Target Start/End: Complemental strand, 46424194 - 46424154
Alignment:
| Q |
189 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46424194 |
tgttgctcttttaagatgaagcgatgaattcattaaatata |
46424154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 189 - 229
Target Start/End: Complemental strand, 9453007 - 9452967
Alignment:
| Q |
189 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
229 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9453007 |
tgttgctcttttaagatgaagcggtaaattcattaaatata |
9452967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University