View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_103 (Length: 282)
Name: NF1107_low_103
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 49095127 - 49095180
Alignment:
| Q |
159 |
ggagtggtttctattccatcacatttcactgtttacattcattttattttccct |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49095127 |
ggagtggtttctattccatcacattacactgtttacattcattttattttccct |
49095180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 78
Target Start/End: Original strand, 49094565 - 49094616
Alignment:
| Q |
27 |
gtgagatgaaagactgaaattatatgcataatcaacacacatgtaatatata |
78 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
49094565 |
gtgaaatgaaagactgaaattatattcataatcaacacacatttaatatata |
49094616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 70 - 127
Target Start/End: Original strand, 49095042 - 49095099
Alignment:
| Q |
70 |
taatatatagaagttttattgatagtgtatcagagtgagtgaaatggaatgatattcc |
127 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||| ||||||| ||||||||||| |
|
|
| T |
49095042 |
taataaatagaagttttattgatagtataacagagtgaatgaaatgaaatgatattcc |
49095099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University