View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_112 (Length: 267)
Name: NF1107_low_112
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 33 - 182
Target Start/End: Complemental strand, 35956281 - 35956132
Alignment:
| Q |
33 |
ttttcctgatgacttcagtaccaaccatgcgaatttctctctagtgttcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
132 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35956281 |
ttttcctgacgacttcagtaccaaccatgcgaatttctctctagcattcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
35956182 |
T |
 |
| Q |
133 |
ctagcnnnnnnnnattcttttcttcttgttcaaccgtttaaaatattatt |
182 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
35956181 |
ctagcttttttttatccttttcttcttgttcaaacgtttaaaatactatt |
35956132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University