View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_112 (Length: 267)

Name: NF1107_low_112
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_112
NF1107_low_112
[»] chr5 (1 HSPs)
chr5 (33-182)||(35956132-35956281)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 33 - 182
Target Start/End: Complemental strand, 35956281 - 35956132
Alignment:
33 ttttcctgatgacttcagtaccaaccatgcgaatttctctctagtgttcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct 132  Q
    ||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35956281 ttttcctgacgacttcagtaccaaccatgcgaatttctctctagcattcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct 35956182  T
133 ctagcnnnnnnnnattcttttcttcttgttcaaccgtttaaaatattatt 182  Q
    |||||        || ||||||||||||||||| ||||||||||| ||||    
35956181 ctagcttttttttatccttttcttcttgttcaaacgtttaaaatactatt 35956132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University