View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_115 (Length: 253)
Name: NF1107_low_115
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_115 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 42518557 - 42518310
Alignment:
| Q |
1 |
aaaagaaacaactcaagcaggtacacgtactttactttctcgctcacaagnnnnnnnnnnnnnnnnnntctagtagacactgatggtttttatacagcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42518557 |
aaaagaaacaactcaagcaggtacacgtactttactttctcgctcacaagacacacacacacacactctctagtagacactgatggtttttatacagcag |
42518458 |
T |
|
| Q |
101 |
ctttaagcttttccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518457 |
ctttaagcttttccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaatta |
42518358 |
T |
|
| Q |
201 |
ttaccacgttatttgttatggacactttatttatttgcctatgatact |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
42518357 |
ttaccacgttatttgttatggacactttatttatttgtctttgatact |
42518310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University