View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_118 (Length: 251)
Name: NF1107_low_118
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45712727 - 45712487
Alignment:
| Q |
1 |
aactacaggaggcttaacatattttttggaggcctgcgcatggaatgttgaaatcatagaagaatggtgttcatcatctaactgcttcttctgggacctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45712727 |
aactacaggaggcttaacatattttttggaggcctgcgcatggaatgttgaaatcatagaagaatggtgttcatcatctaactgcttcttctgggacttc |
45712628 |
T |
 |
| Q |
101 |
aaacgaaagatgacaaatattgaaaccacaatgactactaaaaatgctattgaaatcacaataagtgatgttttcataatgagtagattggatagagtac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
45712627 |
aaacgaaagatgacaaatattgaaaccacaatgactactaaaaatgctattgaaatcacaataagtgatgttttcataacgagcagattggatagagtac |
45712528 |
T |
 |
| Q |
201 |
cagtctcctttcctgctgcaggtaattgacattgattcatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45712527 |
cagtctcctttcctgctgcaggtaattgacattgattcatc |
45712487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University