View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_124 (Length: 251)
Name: NF1107_low_124
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_124 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 21114576 - 21114337
Alignment:
| Q |
13 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaatcagtcaaagatccatcattacggtatatatggtttggtcacttaattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21114576 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaattagtcaaagatccatcattacggtaaatatggtttggtcacttaattt |
21114477 |
T |
 |
| Q |
113 |
cttgatgacaaagaaacatgttagtgcttgtcatgtacaaaatatatgtgaaaaataca-ggtatagtgtcaaattttagtgtcagtctcagattagtga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
21114476 |
cttgatgacaaagaaacatgttagtgcttgtcatgtacaaaatatatgtgaaaaatacagggtatagtgtcaaattttagtctcaggctcagattagtga |
21114377 |
T |
 |
| Q |
212 |
aaaatacaaaaggccaactttgtagttggaataagttgtc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21114376 |
aaaatacaaaaggccaactttgtagttggaataagttgtc |
21114337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 21122003 - 21121935
Alignment:
| Q |
13 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaatcagtcaaagatccatca |
81 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| | |||| ||| |||||| |||||||||||| |||| |
|
|
| T |
21122003 |
aatatttgccatcaagtaaaggcaacctgataatataatcatgtgcacaaaccagtcaaagatctatca |
21121935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University