View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_125 (Length: 250)
Name: NF1107_low_125
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_125 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 28 - 174
Target Start/End: Original strand, 33678478 - 33678624
Alignment:
| Q |
28 |
agttatgagttgaaattgtctattcaaacggtcaaaggaagaagtcccttaaaaactagagtttgcagccttctcaatatgtttaatataccaaggcatg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33678478 |
agttatgagttgaaattgtctattcaaacggtcaaaggaagaagtcccttaaaaactagagtttgcagccttctcaatatgtttaatataccaaggcatg |
33678577 |
T |
 |
| Q |
128 |
gattgacacttatatgtagttgactaatcaagatcaagaatttatag |
174 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33678578 |
gaatgacacttatatgtagttgactaatcaagatcaagaatttatag |
33678624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Original strand, 33678666 - 33678700
Alignment:
| Q |
216 |
caacattcttggcgcagacaagacgaaattgcttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
33678666 |
caacattcttggcgcagacaagacgaaattacttt |
33678700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University