View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_128 (Length: 249)
Name: NF1107_low_128
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_128 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 41225459 - 41225342
Alignment:
| Q |
67 |
ctagggctttgtgttaaatcatcagacttatacttctcaccatgtcccaagatagaactcttgaatggtgacacaacagattgtggagattccatgatat |
166 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41225459 |
ctagagctttgtgttaaatcatcagacttatacttctcaccatgtcccaagatagaactcttgaatggtgacacaacagattgtggagattccatgatat |
41225360 |
T |
 |
| Q |
167 |
cagagtcaataggaacct |
184 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41225359 |
cagagtcaataggaacct |
41225342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 41225563 - 41225496
Alignment:
| Q |
1 |
ccctagcttgatgtatgtaaacatcaactactccaataaattcctctggattagacactgcaacagct |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41225563 |
ccctagcttgatgtatgtaaacatcaactactccaataaattcctctggattagacactgcaacagct |
41225496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University