View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_131 (Length: 228)
Name: NF1107_low_131
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_131 |
 |  |
|
| [»] scaffold0041 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 85 - 228
Target Start/End: Complemental strand, 15203 - 15060
Alignment:
| Q |
85 |
agtgaatgagatgatacctgagcaagaccacgtccagtgattacaccaacccttgcagataagtactgaaagaagatagcggcaaaattgaaaataagag |
184 |
Q |
| |
|
||||||||| ||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| || | |
|
|
| T |
15203 |
agtgaatgacatgatacctgagcaagatctcgtccagtgattacaccaacccttgcggataagtactgacagaagatagcggcaaaattgaaaattagcg |
15104 |
T |
 |
| Q |
185 |
taaaagtcatgagacgaaaaccaaacctcgcaccaccttctata |
228 |
Q |
| |
|
||||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
15103 |
caaaagccaccagatcaaaaccaaacctcgcaccaccttctata |
15060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 55
Target Start/End: Complemental strand, 15507 - 15457
Alignment:
| Q |
5 |
caatttccagttccatataaacttccaaatttagtctatcaaaactgaatt |
55 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
15507 |
caatttccagtttcatataaacttccaaatttagtctgtcaaaactcaatt |
15457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 87
Target Start/End: Complemental strand, 15374 - 15341
Alignment:
| Q |
54 |
ttcttctcaatagcaaggtgctacattaaatagt |
87 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
15374 |
ttcttctcaatagcaagttgctacattaaatagt |
15341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 26458241 - 26458323
Alignment:
| Q |
5 |
caatttccagttccatataaacttccaaatttagtctatcaaaactgaattcttctcaatagcaaggtgctacattaaatagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458241 |
caatttccagttccatataaacttccaaatttagtctatcaaaactcaattcttctcaatagcaaggtgctacattaaatagt |
26458323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 85 - 169
Target Start/End: Original strand, 26458380 - 26458464
Alignment:
| Q |
85 |
agtgaatgagatgatacctgagcaagaccacgtccagtgattacaccaacccttgcagataagtactgaaagaagatagcggcaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458380 |
agtgaatgagatgatacctgagcaagatgacgtccagtgattacaccaacccttgcagataagtactgaaagaagatagcggcaa |
26458464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University