View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_37 (Length: 428)
Name: NF1107_low_37
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 7e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 150 - 364
Target Start/End: Complemental strand, 1006735 - 1006521
Alignment:
| Q |
150 |
cataggttgtggctacaagaattaaagttgtatgaaggtatgagtttggacgtgggtattttaaaaaatatgggtataaggaaaaatagtgtaatatttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1006735 |
cataggttgtggctacaagaattaaagttgtatgaaggtatgggtttggacgcgggtattttaaaaaatatgggtataaggacaaatagtgtaatatttt |
1006636 |
T |
|
| Q |
250 |
atatagatcctaccaattgatatccctatatgatatttcccttttttaatgaacaaaagggggataacctgaagaaacaaaattataaacctctagcaaa |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1006635 |
atatagatcctaccaattcatatccctatatgatatttccctttttttatgaacaaaagggggataacccgaagaaacgaaattataaacctctagcaaa |
1006536 |
T |
|
| Q |
350 |
tagggtactttaatt |
364 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1006535 |
cagggtactttaatt |
1006521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University