View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_38 (Length: 421)
Name: NF1107_low_38
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 42519067 - 42519254
Alignment:
| Q |
8 |
caccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaatccccctagatttcagtgcacctgtgtgtg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519067 |
caccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaatccccctagatttcagtgcacctgtgtgtg |
42519166 |
T |
 |
| Q |
108 |
tcacttcacgtacctttttgtttgtttctgtttctgcaaatgtaaagggaatccttggaatttctggaaataatggttttaattgtca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
42519167 |
tcacttcacgtacctttttgtttgtttctgtttctgcaaatgtaaagggaatccttgtaatttctggaattaatggttttacttgtca |
42519254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 224 - 415
Target Start/End: Original strand, 42519283 - 42519474
Alignment:
| Q |
224 |
gatataatccttgtaaagtagttttactttttctggtggatgtgattcatctgaaattcctttatgaactttattcattagtttctgctaataaagagaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519283 |
gatataatccttgtaaagtagttttaatttttctggtggatgtgattcatctgaaattcctttatgaactttattcattagtttctgctaataaagagaa |
42519382 |
T |
 |
| Q |
324 |
tagaatatatctcttttctggtcttaaaccccgattatatggaacgagggtcctggtaatctgaagctcgaccaagagatgagtataatcta |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
42519383 |
tagaatatatctcttttctggtcttaaaccccgattgtatggaacgagggtccaggtaatctgaagcttggccaagagatgagtaaaatcta |
42519474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University