View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_39 (Length: 421)
Name: NF1107_low_39
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 76 - 329
Target Start/End: Complemental strand, 3678773 - 3678520
Alignment:
| Q |
76 |
caataatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcacct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678773 |
caataatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcacct |
3678674 |
T |
 |
| Q |
176 |
taaaagtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678673 |
taaaagtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaac |
3678574 |
T |
 |
| Q |
276 |
atattcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678573 |
atattcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
3678520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University