View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_44 (Length: 411)
Name: NF1107_low_44
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 62 - 398
Target Start/End: Complemental strand, 32191091 - 32190755
Alignment:
| Q |
62 |
tccaccttcagacttttccgcatcattacctttgtggtgatccggtttggaagaaggtggaggtgtcgtggccgcatcatgacctttgggatgataacca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191091 |
tccaccttcagacttttccgcatcattacctttgtgatgatccggtttggaagaaggtggagcagtcgtggccgcatcatgacctttgggatgataacca |
32190992 |
T |
 |
| Q |
162 |
tgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagcct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190991 |
tgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagcct |
32190892 |
T |
 |
| Q |
262 |
ccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaacttgattgtgctgcctctgctacaatttttgcactcgccataagctc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190891 |
ccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaacttgattgtgctgcctctgctacaatttttgcactcgccataagctc |
32190792 |
T |
 |
| Q |
362 |
gctggttgaaatcttcttctcttccccatggctccct |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190791 |
gctggttgaaatcttcttctcttccccatggctccct |
32190755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 161 - 259
Target Start/End: Complemental strand, 32210367 - 32210269
Alignment:
| Q |
161 |
atgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagc |
259 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
32210367 |
atgcagataatcagcagctttatcaacatatgatcctacacctttctgatcatccaatttagcatactgaccaactgcatctagaagatcaccagcagc |
32210269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 304 - 385
Target Start/End: Complemental strand, 32210242 - 32210161
Alignment:
| Q |
304 |
ctttccccaaacttgattgtgctgcctctgctacaatttttgcactcgccataagctcgctggttgaaatcttcttctcttc |
385 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||| | |||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32210242 |
ctttcccaaaacctgactgtgctgcctctgctactacctttgcacttgccattagctcactggttgaaatcttcttctcttc |
32210161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9452967 |
tatatttaatgaatttaccgcttcatcttaaaagagcaaca |
9453007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46424154 |
tatatttaatgaattcatcgcttcatcttaaaagagcaaca |
46424194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University