View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_55 (Length: 377)
Name: NF1107_low_55
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 108 - 295
Target Start/End: Complemental strand, 43768206 - 43768018
Alignment:
| Q |
108 |
agttggaaccattggtgttaacatttgcaactcagcaaacatctgtacgtgccaaatgcaaaattaaggttagagttttatgattgatttcatgtccaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43768206 |
agttggaaccattggtgttaacatttgcaactcagcaaacatctgtacgtaccaaatgcaaaattaaggttagagttttatgattgatttcatgtccaag |
43768107 |
T |
 |
| Q |
208 |
ttaagtagtatatgctctgtgcctccacagtatttatca-ttcgaaaactgtgcaatatgtccacatcttagaatttcctctacctatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43768106 |
ttaagtagtatatgctctgtgcctccacagtatttatcatttggaaaactgtgcaatatgtccacatcttagaatttcctctacctatg |
43768018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University