View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_65 (Length: 358)
Name: NF1107_low_65
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_65 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 44 - 236
Target Start/End: Complemental strand, 113132 - 112940
Alignment:
| Q |
44 |
actatagtataggtaatctgttgctaatcattcttttaacaaaatatttgttaatgagtttacccacggtcaagccctgtgaaaggtatgtgattgttga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113132 |
actatagtataggtaatctgttgctaatcattcttttaacaaaatatttgttaatgagtttacccacggtcaagccctgtgaaaggtatgtgattgttga |
113033 |
T |
|
| Q |
144 |
gtattttacccacaactaagccttcggtaatataaaataaaaaattgacataatatttcatctataatgcaaaaattatgaagattatgcatc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113032 |
gtattttacccacaactaagccttcggtaatataaaataaaaaattgacataatatttcatctataatgcaaaaattatgaagattatgcatc |
112940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 358
Target Start/End: Original strand, 42519126 - 42519158
Alignment:
| Q |
326 |
ccttttttcaatccccctagatttcagtgcacc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42519126 |
ccttttttcaatccccctagatttcagtgcacc |
42519158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University